Darwinned writes "Intelligent Design is still a hot topic, as evidenced by recent legislation mandating that it be taught in school. Pro-ID group Discovery Institute has released an evolution textbook for use in schools, but a review shows it to be chock full of bad science and questionable reasoning. 'The book doesn't only promote stupidity, it demands it. In every way except its use of the actual term, this is a creationist book, but its authors are expecting that legislators and the courts will be too stupid to notice that, or to remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion.'"
What's unconstitutional is putting it into the science curriculum at public schools (violating the establishment clause of the first amendment). As far as "forcing people to teach ____," all public school curriculum is "forced" on teachers in the sense that it is established at the state and local government level.
Were Unicorns mentioned in the Bible before Noah? (The Irish Rovers song doesn't count)
Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism" (YEC for short)
There are people of many Faiths that believe in Creation and a Creator, but that the Creation event was many (billions) of years ago, not 4004BC, and that the cosmos and the creatures therin have evolved over that (long) time.
Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism"
(YEC for short)
That would be very convenient for the creationists, because YEC is disappearing these days. The creationists have learned that if they make definite scientific statements (e.g, that the Earth is 6000 years old), they risk being proved wrong by scientific evidence. Instead, they've learned to say vague, fuzzy things about intelligent design, while avoiding making testable statements about facts.
There are people of many Faiths that believe in Creation and a Creator, but that the Creation event was many (billions) of years ago, not 4004BC, and that the cosmos and the creatures therin have evolved over that (long) time.
Right, and those people aren't creationists. The wikipedia article gives a good definition of creationism: "Creationism is the religious belief that humanity, life, the Earth, and the universe were created in their original form by a deity (often the Abrahamic God of Judaism, Christianity and Islam) or deities, whose existence is presupposed.[1] In relation to the creation-evolution controversy the term creationism (or strict creationism) is commonly used to refer to religiously-motivated rejection of evolution.[2]" In other words, the commonly accepted definition of creationism is that it's in contradistinction to evolution, so the people you're describing, who accept evolution, aren't creationists. "Creationism" is just one of those words that doesn't mean exactly what you'd think it meant based on its etymology. For comparison, "communism" doesn't mean belief that people should live in communes, and a "Republican" in the US isn't defined as someone who's happy that our form of government is a republic.
I want someone to hit the nail on the head with creationisms, but no one seems to ever do that online so I'll give it my best shot.
Evolution in no way denounces god. Even the Catholic church says the view science has on the universe and evolution are compatible with their faith: http://rellavent.blogspot.com/2008/09/catholic-church-acknowledges-evolution.html [blogspot.com]
And it's pretty easy to reconcile the two: universe created in a big explosion that created light, land and heaven coalescing into stellar bodies, water and land separating as it cools, life slowly taking to the land, and man ultimately being removed from the bliss of the primordial garden by eating the fruit of knowledge. It's god, if evolution happened without his help at all, he set up the universe knowing full well what it would do. ID in the 6k year old vein makes no sense and actually is insulting to the power of god.
This brings up the problem of the creationists. Science as it is written, is not in that strong of a conflict with the bible as it is written, so why do they continue to push it?
we know the symptoms: text books, politicians, online spaming, but what causes the disease?
Or to frame it in a more humanistic perspective: what do they gain by perusing their agenda? This should be the prime argument in creationism, not the symptomatic treatment that has been prevalent.
My theory is that creationism is viewed as being linked to a value system that creationists view as being under attack from secular radicals, and evolution is taken as a battle field to fight against this because Evolution is pretty removed from their day to day lives, if they chose to believe fantasy on it they wont hurt them selves like they would if they choose to believe fantasy about refrigeration. Basically they are picking ID as the place to make their stand to defend their way of life.
That brings up the other point, why do they feel their way of life is in danger? It could be politicians playing it up for votes, it could be changing social economics beyond anyones control, it could be pure paranoia, and it could be that people in the cities and scientific community actually attack them. I think its a combination of all those factors, but i also think one of the largest factors is the fact that Secular atheists do actively attack the religious beliefs of others.
I know this from having been to several meetings. The atheist community is one of the most bitter and spiteful I have ever seen and actively wish to see all "non-rational" belief systems torn down and replaced with their "belief" system on a level that matches any religion. Pure tribalism at its best, two sets of group-think throwing stones at each other. the Atheists attack christen beliefs and they attack the atheists through ID.
The solution to the problem is not the one shown on/. of armchair intellectuals decrying the ignorance of the bible belt hicks, while smugly reassuring each other that they have the "best" ideology. It is through an understanding of their actions and why they do them and coming to terms with them. Calling their text book stupid isn't going to get them to stop. I don't know what the solution is, but I know what it isn't.
Science as it is written, is not in that strong of a conflict with the bible as it is written
Perhaps not if you don't take the bible literally. But many do. And science is, and let's not mince words here, absolutely and completely at odds with the bible as it is written, should it be interpreted as literal text.
Now, I've never understood anybody who said they believed in the bible but didn't take it literally. What. The. Fuck.
OK, how about: "I believe in The Complete Works Of Shakespeare, but I don't take it as a literal historical document." Say what now? What does "believe in" *mean* then?!
Nah mate, science and Christianity are NOT compatible, so long as Christianity promotes any kind of belief that is either at odds with provable fact, or is not supported by any direct evidence.
And just to be clear, attributing unknown or unexplained things to god is *never* a reasonable theory because that logic requires the concept of god in the first place, which (if you spend any amount of time thinking about it) you should know is circular reasoning and therefore crap. One of the fundamentals of the scientific method is never to search only for facts to fit a theory, but rather to constantly revise the theory to fit the facts. This precludes the possibility of the concept of "god" to ever factor in to any scientific theory because there was never any direct evidence to cause the scientist to develop the concept and theory of a god.
Personally, I find religion deeply offensive, in the same way I find littering, racism, homeopathy, and liars offensive. If anybody is going to be doing any of that on my lawn, I'm going to yell at them.
Now, I know exactly the tribal mentality you mention, but that is human nature and humanity will always have a Complete Dick contingent. However, I certianly do not need smug reassurance from anybody else whose beliefs line up with mine. My smug reassurance comes from ascribing to verifiable truth, which stands on a mountain of evidence, and holds its own.
Ah, but the beauty of YEC is that it really can't be disproven. Any time you have evidence that the Earth is older, all they need to say is that God created it to look older.
This is fundamentally why YEC should not be taught in a science classroom. It is not disprovable and thus not science.
Since you seem like a friendly fellow I'll save you a little money. Every issue of the newsletter just contains the same two words, in large type on the front page, and nothing else.
All the YEC apologists I've encountered believe in a deity who is incapable of deception. Their deity didn't make the world appear old even though it was young, they believe the earth IS young and all the science we rely upon is flawed.
The Pastafarians are the ones who claim the earth is young, but the FSM made it appear old.
I've met many creationists who, for example, thought that fossils were put there because of the flood and they just happen to line up in what appears to be a historical record because God is testing their faith.
i would counter with "aliens came down and inserted a probe in your rectum, but before they could finish inserting the other 1/2 of your brain you started gyrating with enjoyment over the anal penetration and they had to pull out"
if people really want to be so dense that they make up bullshit like that i say we just have fun with them....
In the US, its not fashionable to know math or science. It's not fashionable to work hard. 'Being liked' is in. Girls are encouraged to look pretty and boys are encouraged to be force wielding leaders (to later wind up as PHB's?).
Look at kids' movies and TV shows. The message is that all you have to do is believe in yourself. Nothing else. God forbid we ask these delicate flowers to do more than the minimum.
Prosperity is being taken as a birthright. I half wonder if the outcry against illegal aliens is due to the fact that these people work hard. The complainers may one day be expected to. Can't have that!
Good point. Instead, we got good looking genius boy.
"Trees cause more pollution than automobiles do." -- Ronald Reagan, 1981
"I have flown twice over Mt St. Helens out on our west coast. I'm not a scientist and I don't know the figures, but I have a suspicion that that one little mountain has probably released more sulfur dioxide into the atmosphere of the world than has been released in the last ten years of automobile driving or things of that kind that people are so concerned about." -- Ronald Reagan, 1980. (Actually, Mount St. Helens, at its peak activity, emitted about 2,000 tons of sulfur dioxide per day, compared with 81,000 tons per day by cars.)
"The American Petroleum Institute filed suit against the EPA [and] charged that the agency was suppressing a scientific study for fear it might be misinterpreted... The suppressed study reveals that 80 percent of air pollution comes not from chimneys and auto exhaust pipes, but from plants and trees." Presidential candidate Ronald Reagan, in 1979. (There is no scientific data to support this assertion.)
What's really bugged me the most about Intelligent Design is that its proponents attacked the wrong target.
As I understand science, it's a cycle: observe, explain, hypothesize, test; and repeat. Evolution as a theory, holds to this cycle. But Intelligent Design is just: observe and explain- the explanation being essentially "God did it." There's not much reason to keep examining things when you feel you've reached that stage, is it? It's an intellectual dead end.
If *I* were in charge of promoting/legitimizing ID, I would put it up against the Big Bang/String theorists and the like. When we can't yet explain why the universe is the way it is on a fundamental (quantum?) level, *THAT's* when you can trot out the "God did it"s. Evolution is just too well researched and tested a subject to topple (logically and rationally, that is).
What's really bugged me the most about Intelligent Design is that its proponents attacked the wrong target.
That's because you and the religious fundamentalist leaders have different goals.
If *I* were in charge of promoting/legitimizing ID, I would put it up against the Big Bang/String theorists and the like.
ID isn't about finding science that is sufficiently speculative and trying to insert "God". It's about finding science that is sufficiently confusing to the average person so that some will be able to be convinced while others will not. If there isn't strong controversy, then people don't get emotional and angry and feel they need to fight and give exploiters money to help with the fight.
If they weren't laughed at so hard, they'd be arguing that the sun revolves around the earth, because that is in conflict with absurdly literal interpretations of the bible. In fact, in some poorly educated communities, they are making that argument. It's just too absurd for the mainstream US (who can understand enough astronomy or at least see the pictures, to understand otherwise). So they pick the most outrageous untruth possible that they can talk a significant number of ignorant saps into believing. That way there are two "sides" and the religious can feel they are being attacked and need to strike back, by sending their money in and casting their votes to fight for their religion... even though mainstream christianity moved on and has accepted evolution (and heliocentrism) for a long time.
Evolution is just too well researched and tested a subject to topple (logically and rationally, that is).
And that is where you fail. They aren't interested in logic or reason, but in emotionally charged attacks and intentionally spread confusion as a way of manipulating the sheep. Seriously, how many of these so called scientists and preachers do you think have any interest in really promoting christianity instead of making a buck or getting elected? If they were really christians they'd be focusing on the core message of Jesus, which is still not well understood; things like reacting to violence with nonviolence and treating people you disagree with peacefully and respectfully in spite of said disagreement.
I don't live in the US, but have read heaps about this topic. My real question is why the subject is even being considered being added to the US school curriculum. There are lame attempts and arguments that go along the line of we want to be "balanced", but, frankly, creationism is not accepted science (it doesn't even come close to science). It's great to debate these things (it broadens our minds), but schools should teach fact; not conjecture.
Evolution is not "fact" either (although the accumulated data supports the theory). If another theory comes along that explains the data better, then Darwin's theory will be superseded. This is how science works. Teaching crackpot "theories" in schools doesn't end up making people more objective. I would suggest that it teaches them to be more stupid. Teach critical thinking. Don't teach things that are not falsifiable. It's easy.
i don't think you are going to find much support for this textbook on slashdot
however, what you will find is a lot "hear, hear" and then... nothing. or worse, cynicism
there's a lot of issues in this world where all you can do is whine and bitch and moan, and are otherwise helpless to effect change. this is not one of those issues
ALL of these creationist initiatives are happening on state and local levels. you CAN do something about it if you live in one of these areas
if you do live in an area creationists are making headway, do something about it, please. if for nothing than else than simple civic pride, that the residents of your {state/ town} are not all ignorant buffoons, that some of you actually understand the value of a critical mind, and even more importantly, understand the value of an involved electorate and citizens active for causes they believe in
how is it possible that such idiots can get creationism in our schools? because THEY GET INVOLVED
there are too many voices here on slashdot that will speak loudly about right and wrong, and never actually get involved to make sure their government stands up for that
please, do not feed me the standard psychological lines of learned helplessness that convinces you you can effect no change on this issue or that issue. on creationism, on a state and local level, you CAN do something about this. you SHOULD do something about this. DO IT
"Intelligent Design is still a hot topic, as evidenced by recent legislation mandating that it be taught in school."
Umm, the linked article says nothing about ID being mandated, it talks about legislation that would allow schools to teach it, not require them to do so. It's dumb legislation, but attacking intellectual dishonesty with more intellectual dishonesty doesn't really help your case.
Mainly because they don't only want to teach their children this stuff but they want to force public schools to teach every child this stuff. It is a slippery slope. Once they teach "the controversy" what else will they want to tech?
The reason they don't teach what you say is because it is false. It simply isn't true that evolution is "a broken, flailing ship being tossed from its course every five years" or that evolution is popular because it appeals to atheists. You have to know something about evolutionary biology to understand why the former is false, but to see that the latter is false you need only realize that there are far fewer atheists than people who accept evolution and that many non-atheists, including most Jews, Catholics, and mainline Protestants, accept evolution.
Incidentally, it is quite possible to believe in god without believing in the literal truth of Genesis. Numerous people outside the Judaeo-Christian tradition do. And on the other hand, evolution is hardly necessary to discredit literal belief in Genesis. Genesis isn't even internally consistent.
Why are we fighting this? It's futile. Let them believe what they will believe, let them teach what they want
If that's the case, why are you posting your own opinion on slashdot? Let the slashdot readers believe what they will believe and let the submitters submit what they want.
You fail to understand that if they do WHATEVER IT TAKES to convince other people of their truth, those converted people will do WHATEVER IT TAKES to convince EVERYONE of their truth. If we don't do anything to stop them, soon it will be 1984 all over the country. And I'd say we're on the edge of seeing that happening.
When I'm a decade or two older, the young people who will be affected by these decisions today will just be entering the workforce, bringing their bright new ideas into focus, and beginning to drive the next round of scientific and technological advances.
I do not want these people to believe that one of the most successful, important, and useful scientific theories in history is a lie. I do not want these people to believe that "God did it" is any kind of reasonable scientific answer. I don't want the doctors and medical researchers who determine the length and quality of my old age to be spouting off about "irreducible complexity" and other such nonsense.
You're wrong about losing the battle. Here we are conversing on a globe-spanning information network using unimaginably powerful computing machines. We've always won, and we'll keep on winning, because in the end we're right and they're wrong. But it won't be thanks to people like you.
Sadly in places people defend your ignorant view. As if there's a middle road here. "Teach both", or "there's room for more then one theory".
Evolution is one of the cornerstones for modern biology. You don't want it taught even though it has withstood over 100 years of scrutiny and is incredibly accepted by the scientific community? Why? Because you don't understand it most likely.
Years ago when Georgia was going through the ID vs Evolution in school issue I saw the national media on site at a high school ask a local student his thoughts. He responded that he wanted ID taught because he knew evolution was full of holes and he could disprove it himself.
Well step up young man and claim your Nobel prize that's waiting you.
Where did he get his (mis)information from? It's not the local drug dealers. It's not the science classes. It's not video games. It's the churches.
There are many churches that deal in lies to peddle their agenda of pushing evolution out of the classroom. It's not a conspiracy theory it's a fact of life in this country.
If man came from monkeys why are there still monkeys? People ask that because they've been told that. They've been told that is a hole in evolutionary theory so they parrot it. They aren't told that at the drive through line at McDonalds. They are only told that type of information in religious circles.
I used to argue with Answers in Genesis for years. It was like pulling teeth trying to get them to remove content that was completely non-factual or completely taken out of context. Letter after letter would be sent with references to the correct information, but it would take months or years (or sometimes never) to get them to correct their website. Even though they updated their site regularly. There was no incentive for them to provide correct information because incorrect information is the only way they could build their case against evolution.
The fact that some Christians can't reconcile their religion with a very well grounded theory that has withstood the rigors of science for over 100 years isn't my problem.
WTF are you talking about? Why do you think Evolution is on less solid grounds than, say, quantum theory or heliocentrism? For heliocentrism, we have probes and satellites taking nice pictures. For evolution, we have fossils backed by geology, chemistry, atomic physics and so on; we also have ****DNA*** fucking SEQUENCING. Where do you think biologist get those ATTAACGGGCGTGTAAGGCGTGAAA... ? Random number generators? Do you have an alternate explanation for Polymerase Chain Reaction? Well then, if you agree with DNA sequencing, how do you explain that everything we sequence fits just right with evolutionary theory? Evolution is much more obvious than most of quantum physics or relativity. Do you also have an opinion about frame dragging or black body radiation? What about tunnel effect? What does your bible (or whatever source of superstition is it you use) say about the wave-particle duality? Isn't THAT weirder than natural selection? C'm'on, genes mutate and unfit individuals don't get to reproduce. That's straightforward. But Hawking's radiation? The Standard Model? Is more or less problematic to you than the evolution of species by the means of natural selection? And we both agree that alchemy shouldn't be taught in the classroom, are you going to ask that chemistry, too, be withheld? What about astrology and astronomy?
No, you do not. You subscribe to an unsupported and unsupportable myth, and see nothing wrong with your personal mythology being taught to children as established fact. That makes you not only ignorant, but dangerous. Look, the human race already suffered through a long interval of ignorance and misery, with reason taking a back seat to religion. We know that time as the Dark Ages. People who clung to their beliefs in spite of all evidence to the contrary were responsible, and it could happen again.
We'll see how your faith holds up when the lights go out for good. Civilization is fragile. Believe it.
In your first paragraph, you are making an a priori assumption that schools which teach ID also teach critical thought. I find that very unlikely, since acceptiong ID requires limited critical thinking abilities.
As per the bias of the reviewer, well that's pretty obvious. I think part of the reason impartial dialog is becoming increasingly scare among evolution proponents is due to the techniques ID proponents have employed. While I agree the entire debate needs to be had at a lower grade level, so that everyone can partake, I don't think the maturity should sink to the same grade level. And I'm certain this last statement appears biased to a pro ID reader.
The main thing that bothers me is the cultural framework this creates of closing science into dogma.
Darwin's Black Box anybody. Whether or not you agree w/ his conclusions or not he does not make a stupid argument.
Darwin's Black Box [wikipedia.org] was shown to be wrong in the Dover trial. Behe's central premise that things are irreducibly complex was proven wrong both with hard scientific data (about the flagella being irreduceably complex, but the bacterial Type III secretory system has a subset of the parts, though they serve a different function) and logically (Behe says a mousetrap is irreducibly complex, but it is useful as a tie clip if you remove two key parts).
We therefore find that Professor Behe's claim for irreducible complexity has been refuted in peer-reviewed research papers and has been rejected by the scientific community at large.
Regardless of those two examples, the entire concept of irreducible complexity is complete bullshit.
Evolution does not simply add parts. It also removes them. And indeed there is a great incentive for this to happen, as every unnecessary part is an added metabolic cost to the organism which contains it.
So let's say for a moment that some structure was discovered that were irreducibly complex. Does that disprove evolution? Absolutely not! It just means that the structure evolved from something more complex, not less.
I'm not sure how best to explain it so I'll try with a simple example.
Let's say the structure you're trying to evolve can be represented as ABC. The letters are different parts. Together, ABC performs some useful function. Maybe it senses light, or moves the organism, or converts energy. Doesn't matter.
Now imagine that AB and BC are both useless constructs. The stance of the IDers is that ABC would have to evolve from constituent parts, by starting with one letter and adding more until ABC is achieved. But, they claim, since both AB and BC are useless, they would never evolve, and so ABC could never come to be. Therefore, the existence of ABC in an organism is, essentially, proof that God Did It.
However, imagine if C is some sort of useful construct all by itself. The actual function of C could be completely different from the function of ABC, it just has to be useful in some fashion. Then we add D, another part which is not part of ABC, to form CD. Imagine that CD is also useful in some manner, potentially related to C, potentially not. Then B is added which gives it more of a useful function, so organisms have the useful construct BCD. Then A is added to give the final functionality in the more complex form of ABCD. Then D, being redundant, is eventually dropped from the organism. Therefore you have evolved the useful and "irreducibly complex" construct ABC from parts.
When discussing the idea of 'irreducible complexity', it's probably best to consider a simple everyday system which fits the bill.
So: consider the arch bridge.
An arch bridge is held up by internal pressure. Remove any part of the arch bridge and the whole thing falls into the river. An arch bridge is irreducibly complex, by the creationists' definition. It works as a whole, or not at all; take any part away and it collapses.
Does that mean, then, that all the arch bridges in the world were assembled all at once? Shipped pre-fab to the site and installed as a whole?
Not at all! When we build such things, we use scaffolding. We first build a huge, clumsy, inefficient structure, a grid of poles and joints. This structure is flimsy, it cannot bear very great weight, nor carry much traffic - but it does span the river, it is indeed a bridge. And it can be built up piece by piece - it will stand up even if the span is not complete. Then we work on the arch bridge itself. We build up stone alongside our scaffolding. The scaffolding holds up the stone and the stone braces the scaffolding. Each new stone added strengthens the whole structure.
And there comes a day when the arch bridge is completed. Now we find that the whole scaffolding structure is redundant - it can be done away with. That leaves only the arch. The irreducibly complex arch.
The same could easily go for living things. Evolution can take away as well as add, and if some older structure has been made redundant by a newer development that grew from it, then that structure can surely be done away with. Behe's notion of irreducible complexity would only be a problem if evolutionary theory only allowed for organisms to become more complex over time - but if an organism is already complex, and it happens to benefit that species to become simpler, then it will do so. And it might well arrive at an 'irreducibly complex' structure from above.
It's all a hangover of the old idea of a 'great chain of being'. It's a common misconception: men are more advanced than apes, which are more advanced than dogs, which are more advanced than... you get the picture. This is the kind of thinking where the X-Men are the 'next stage' of evolution. Evolution doesn't work that way. There's no great plan, no distant goal, no inevitable increase of sophistication. Evolution does whatever works, and if that means eliminating redundancies, refactoring, and going ahead with a simpler design, then so be it.
The point is that if we were to arrive late on the scene and find an arch bridge, with the scaffolding long gone, we might examine the bridge, realise that if any part were removed then the whole must fall, and conclude that we were looking at an irreducibly complex system.
In fact, of course, the bridge is the remainder of a larger, still more complex system of bridge plus scaffolding, most of which has been removed as being redundant.
The same goes for the supposed 'irreducibly complex' structures put about by creationists. They argue that the removal of any part of such structures would cause the whole to fail completely. Perhaps they're even right. But the discussion of the arch bridge shows that it's possible to arrive at such a structure by subtraction, rather than by addition: the 'irreducible' structure exists as a relic of a more complex, less efficient system, hacked together ad hoc, which did the job poorly but nonetheless did it - and which was then gradually optimised until it achieves the engineer's perfection, when there is nothing left to take away.
You can imply that there is bias all you want, but there is one very big difference between the two. The biologist has studied biology, the scientific process involved in researching the subject and is able to make an evidenced based critique of an ID argument.
Rebuttals from the ID camp contain no such expertise or references, and are usually based on long refuted arguments against evolution, but little or nothing that truly supports ID.
This isn't a case where he-said she-said attempts to discredit both sides will work. One side clearly has evidence on their side, and the other does not.
Pro-ID group Discovery Institute has released an evolution textbook for use in schools, but a review shows it to be chock full of bad science and questionable reasoning
^ These idiots a veneer of respect by treating them as if they're rational? They AREN'T. They are functional (but nevertheless, crazy as a shithouse rat) religious zealots who do not respect science unless it serves their beliefs (see also: nuclear power, IC engine, medicine, etc.).
They are functional (but nevertheless, crazy as a shithouse rat) religious zealots
I think it's worth pointing out - particularly to people in the US - that the Muslim countries of the Middle East led the world in science and technology, once. Why do you think so many stars have Arabic names? Why do so many words in science have Arabic roots? Think carefully...
Now think about what happened when they let the conservative religious crazies take control.
by Anonymous Coward
on Friday September 26 2008, @08:47PM (#25174027)
> Now think about what happened when they let the conservative religious crazies take control.
Methinks history betrays you.
The Wahabbi extremists (Islamic versions of the US fundamentalist extremists) came to power with ibn Saud, in the 18th century.
Economic power (and scientific luminance) seeped away from the Caliphates and kingdoms of the Levant when the sea routes were broken open, most notably and astoundingly at Lepanto.
The fall of the Islamic intellectual tradition wasn't entirely born of their own fundamentalism. It followed the sack of Baghdad [wikipedia.org] by the Mongol horde. The centre of a civilisation stretching from India to Spain, full of the intellectual riches and history of all Eurasia, all burned. The loss of the Library at Alexandria was bad. This was worse.
There followed a long decline. Wars, on and off, with the crusaders of Europe raiding into the Middle East. Various rulers of Arabic and Persian and Turkish dynasties competing for domination of the Islamic world. A gradual eclipse as the nations of Europe set about building their empires. And finally irrelevance, a culture respected only insofar as it provides crude oil to its betters. Small wonder that a civilisation brought so low from such a glorious past turns to its god for answers, and finds dark counsels.
"Therefore, the seeker after the truth is not one who studies the writings of the ancients and, following his natural disposition, puts his trust in them, but rather the one who suspects his faith in them and questions what he gathers from them, the one who submits to argument and demonstration, and not to the sayings of a human being whose nature is fraught with all kinds of imperfection and deficiency. Thus the duty of the man who investigates the writings of scientists, if learning the truth is his goal, is to make himself an enemy of all that he reads, and, applying his mind to the core and margins of its content, attack it from every side. He should also suspect himself as he performs his critical examination of it, so that he may avoid falling into either prejudice or leniency."--Ibn al-Haytham
This is what too few human beings do, they always trust in what they have been taught... when much of what they know is fraught with error. I am weary of anything I say as well as anything any other man says, that cannot be demonstrated. Therefore, I only defend what can be demonstrated.
The majority of people do not take the above view, they are overconfident in what they think they know when they hardly know anything at all.
No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.
If something cannot be questioned, then it does not belong in a science laboratory, it belongs in pulpit in a church. The concept of QUESTIONING is what gives science its bad ass record.
The luminiferous ether was widely regarded as the only way for light to behave the way it did. Light was a wave, and that explained the double slit experiment.
Then a few jerks were just messing around and bang, the ether is GONE. The discovery was so important, it got one of those jerks a Nobel Prize. When somebody says they have an idea that's totally irrefutable, their idea isn't science. Even various aspects of evolution are able to be falsified, for example, if a fossilized cat were found in the Jurassic period, then that would throw common decent right out the window. It's doubtful for that to happen, considering the mountains of evidence that support common decent, but it's never going to be an unquestioned fact. An absolute fact would require absolute proof, and the only tool that provides absolute proof is mathematics.
SCOTUS reference anybody? (Score:4, Insightful)
"
remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion
"
Can someone post a reference. I suspect any actual rulings will be somewhat more nuanced than that broad statement.
Re:SCOTUS reference anybody? (Score:5, Informative)
Parent
Re:SCOTUS reference anybody? (Score:5, Informative)
What's unconstitutional is putting it into the science curriculum at public schools (violating the establishment clause of the first amendment). As far as "forcing people to teach ____," all public school curriculum is "forced" on teachers in the sense that it is established at the state and local government level.
Parent
Re:SCOTUS reference anybody? (Score:5, Informative)
Piyush Jinda, Governor of Louisiana (George Bush with a funny name, if you ask me) is trying to sneak this shit right back in.
Louisiana: Last on the good lists, first on the bad lists, and determined to keep it that way.
I can say that because I'm a rare escapee from that temple to ignorance. Still, it's a lot of fun to visit the Bayou State.
Parent
Re:SCOTUS reference anybody? (Score:5, Insightful)
Atheism is a religion.
Atheism is a religion like not collecting stamps is a hobby.
Parent
Table Of Contents (Score:5, Funny)
2 - The Great Flood (Where are all the Unicorns?)
3 - Jesus, Dinosaur Wrangler
4 - Darwin, What a Jerk.
5 - The Scientific Method - Hooey or Baloney?
2 - The Great Flood (Where are all the Unicorns?) (Score:5, Insightful)
Were Unicorns mentioned in the Bible before Noah? (The Irish Rovers song doesn't count)
Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism"
(YEC for short)
There are people of many Faiths that believe in Creation and a Creator, but that the Creation event was many (billions) of years ago, not 4004BC, and that the cosmos and the creatures therin have evolved over that (long) time.
Parent
Re:2 - The Great Flood (Where are all the Unicorns (Score:5, Insightful)
That would be very convenient for the creationists, because YEC is disappearing these days. The creationists have learned that if they make definite scientific statements (e.g, that the Earth is 6000 years old), they risk being proved wrong by scientific evidence. Instead, they've learned to say vague, fuzzy things about intelligent design, while avoiding making testable statements about facts.
Right, and those people aren't creationists. The wikipedia article gives a good definition of creationism: "Creationism is the religious belief that humanity, life, the Earth, and the universe were created in their original form by a deity (often the Abrahamic God of Judaism, Christianity and Islam) or deities, whose existence is presupposed.[1] In relation to the creation-evolution controversy the term creationism (or strict creationism) is commonly used to refer to religiously-motivated rejection of evolution.[2]" In other words, the commonly accepted definition of creationism is that it's in contradistinction to evolution, so the people you're describing, who accept evolution, aren't creationists. "Creationism" is just one of those words that doesn't mean exactly what you'd think it meant based on its etymology. For comparison, "communism" doesn't mean belief that people should live in communes, and a "Republican" in the US isn't defined as someone who's happy that our form of government is a republic.
Parent
Re:2 - The Great Flood (Where are all the Unicorns (Score:5, Insightful)
Evolution in no way denounces god. Even the Catholic church says the view science has on the universe and evolution are compatible with their faith: http://rellavent.blogspot.com/2008/09/catholic-church-acknowledges-evolution.html [blogspot.com] And it's pretty easy to reconcile the two: universe created in a big explosion that created light, land and heaven coalescing into stellar bodies, water and land separating as it cools, life slowly taking to the land, and man ultimately being removed from the bliss of the primordial garden by eating the fruit of knowledge. It's god, if evolution happened without his help at all, he set up the universe knowing full well what it would do. ID in the 6k year old vein makes no sense and actually is insulting to the power of god.
This brings up the problem of the creationists. Science as it is written, is not in that strong of a conflict with the bible as it is written, so why do they continue to push it?
we know the symptoms: text books, politicians, online spaming, but what causes the disease? Or to frame it in a more humanistic perspective: what do they gain by perusing their agenda? This should be the prime argument in creationism, not the symptomatic treatment that has been prevalent.
My theory is that creationism is viewed as being linked to a value system that creationists view as being under attack from secular radicals, and evolution is taken as a battle field to fight against this because Evolution is pretty removed from their day to day lives, if they chose to believe fantasy on it they wont hurt them selves like they would if they choose to believe fantasy about refrigeration. Basically they are picking ID as the place to make their stand to defend their way of life.
That brings up the other point, why do they feel their way of life is in danger? It could be politicians playing it up for votes, it could be changing social economics beyond anyones control, it could be pure paranoia, and it could be that people in the cities and scientific community actually attack them. I think its a combination of all those factors, but i also think one of the largest factors is the fact that Secular atheists do actively attack the religious beliefs of others.
I know this from having been to several meetings. The atheist community is one of the most bitter and spiteful I have ever seen and actively wish to see all "non-rational" belief systems torn down and replaced with their "belief" system on a level that matches any religion. Pure tribalism at its best, two sets of group-think throwing stones at each other. the Atheists attack christen beliefs and they attack the atheists through ID.
The solution to the problem is not the one shown on
Parent
Re:2 - The Great Flood (Where are all the Unicorns (Score:5, Insightful)
Science as it is written, is not in that strong of a conflict with the bible as it is written
Perhaps not if you don't take the bible literally. But many do. And science is, and let's not mince words here, absolutely and completely at odds with the bible as it is written, should it be interpreted as literal text.
Now, I've never understood anybody who said they believed in the bible but didn't take it literally. What. The. Fuck.
OK, how about: "I believe in The Complete Works Of Shakespeare, but I don't take it as a literal historical document." Say what now? What does "believe in" *mean* then?!
Nah mate, science and Christianity are NOT compatible, so long as Christianity promotes any kind of belief that is either at odds with provable fact, or is not supported by any direct evidence.
And just to be clear, attributing unknown or unexplained things to god is *never* a reasonable theory because that logic requires the concept of god in the first place, which (if you spend any amount of time thinking about it) you should know is circular reasoning and therefore crap. One of the fundamentals of the scientific method is never to search only for facts to fit a theory, but rather to constantly revise the theory to fit the facts. This precludes the possibility of the concept of "god" to ever factor in to any scientific theory because there was never any direct evidence to cause the scientist to develop the concept and theory of a god.
Personally, I find religion deeply offensive, in the same way I find littering, racism, homeopathy, and liars offensive. If anybody is going to be doing any of that on my lawn, I'm going to yell at them.
Now, I know exactly the tribal mentality you mention, but that is human nature and humanity will always have a Complete Dick contingent. However, I certianly do not need smug reassurance from anybody else whose beliefs line up with mine. My smug reassurance comes from ascribing to verifiable truth, which stands on a mountain of evidence, and holds its own.
Parent
Re:2 - The Great Flood (Where are all the Unicorns (Score:5, Insightful)
Ah, but the beauty of YEC is that it really can't be disproven. Any time you have evidence that the Earth is older, all they need to say is that God created it to look older.
This is fundamentally why YEC should not be taught in a science classroom. It is not disprovable and thus not science.
Parent
Re:2 - The Great Flood (Where are all the Unicorns (Score:5, Funny)
Your ideas are intriguing to me and I wish to subscribe to your newsletter.
Parent
Re:2 - The Great Flood (Where are all the Unicorns (Score:5, Funny)
Since you seem like a friendly fellow I'll save you a little money. Every issue of the newsletter just contains the same two words, in large type on the front page, and nothing else.
Parent
Re:2 - The Great Flood (Where are all the Unicorns (Score:4, Informative)
All the YEC apologists I've encountered believe in a deity who is incapable of deception. Their deity didn't make the world appear old even though it was young, they believe the earth IS young and all the science we rely upon is flawed.
The Pastafarians are the ones who claim the earth is young, but the FSM made it appear old.
Parent
Re:2 - The Great Flood (Where are all the Unicorns (Score:5, Funny)
I've met many creationists who, for example, thought that fossils were put there because of the flood and they just happen to line up in what appears to be a historical record because God is testing their faith.
Parent
Re:2 - The Great Flood (Where are all the Unicorns (Score:5, Funny)
if people really want to be so dense that they make up bullshit like that i say we just have fun with them....
Parent
revenge on the nerds (Score:5, Insightful)
In the US, its not fashionable to know math or science. It's not fashionable to work hard. 'Being liked' is in. Girls are encouraged to look pretty and boys are encouraged to be force wielding leaders (to later wind up as PHB's?).
Look at kids' movies and TV shows. The message is that all you have to do is believe in yourself. Nothing else. God forbid we ask these delicate flowers to do more than the minimum.
Prosperity is being taken as a birthright. I half wonder if the outcry against illegal aliens is due to the fact that these people work hard. The complainers may one day be expected to. Can't have that!
Re:revenge on the nerds (Score:5, Interesting)
Good point. Instead, we got good looking genius boy.
"Trees cause more pollution than automobiles do." -- Ronald Reagan, 1981
"I have flown twice over Mt St. Helens out on our west coast. I'm not a scientist and I don't know the figures, but I have a suspicion that that one little mountain has probably released more sulfur dioxide into the atmosphere of the world than has been released in the last ten years of automobile driving or things of that kind that people are so concerned about." -- Ronald Reagan, 1980. (Actually, Mount St. Helens, at its peak activity, emitted about 2,000 tons of sulfur dioxide per day, compared with 81,000 tons per day by cars.)
"The American Petroleum Institute filed suit against the EPA [and] charged that the agency was suppressing a scientific study for fear it might be misinterpreted... The suppressed study reveals that 80 percent of air pollution comes not from chimneys and auto exhaust pipes, but from plants and trees." Presidential candidate Ronald Reagan, in 1979. (There is no scientific data to support this assertion.)
Parent
Intelligent Design, Stupid Tactics (Score:5, Insightful)
What's really bugged me the most about Intelligent Design is that its proponents attacked the wrong target.
As I understand science, it's a cycle: observe, explain, hypothesize, test; and repeat. Evolution as a theory, holds to this cycle. But Intelligent Design is just: observe and explain- the explanation being essentially "God did it." There's not much reason to keep examining things when you feel you've reached that stage, is it? It's an intellectual dead end.
If *I* were in charge of promoting/legitimizing ID, I would put it up against the Big Bang/String theorists and the like. When we can't yet explain why the universe is the way it is on a fundamental (quantum?) level, *THAT's* when you can trot out the "God did it"s. Evolution is just too well researched and tested a subject to topple (logically and rationally, that is).
Re:Intelligent Design, Stupid Tactics (Score:5, Insightful)
ID is about as legit as Scientology.
Parent
Re:Intelligent Design, Stupid Tactics (Score:5, Insightful)
What's really bugged me the most about Intelligent Design is that its proponents attacked the wrong target.
That's because you and the religious fundamentalist leaders have different goals.
If *I* were in charge of promoting/legitimizing ID, I would put it up against the Big Bang/String theorists and the like.
ID isn't about finding science that is sufficiently speculative and trying to insert "God". It's about finding science that is sufficiently confusing to the average person so that some will be able to be convinced while others will not. If there isn't strong controversy, then people don't get emotional and angry and feel they need to fight and give exploiters money to help with the fight.
If they weren't laughed at so hard, they'd be arguing that the sun revolves around the earth, because that is in conflict with absurdly literal interpretations of the bible. In fact, in some poorly educated communities, they are making that argument. It's just too absurd for the mainstream US (who can understand enough astronomy or at least see the pictures, to understand otherwise). So they pick the most outrageous untruth possible that they can talk a significant number of ignorant saps into believing. That way there are two "sides" and the religious can feel they are being attacked and need to strike back, by sending their money in and casting their votes to fight for their religion... even though mainstream christianity moved on and has accepted evolution (and heliocentrism) for a long time.
Evolution is just too well researched and tested a subject to topple (logically and rationally, that is).
And that is where you fail. They aren't interested in logic or reason, but in emotionally charged attacks and intentionally spread confusion as a way of manipulating the sheep. Seriously, how many of these so called scientists and preachers do you think have any interest in really promoting christianity instead of making a buck or getting elected? If they were really christians they'd be focusing on the core message of Jesus, which is still not well understood; things like reacting to violence with nonviolence and treating people you disagree with peacefully and respectfully in spite of said disagreement.
Parent
Re:Intelligent Design, Stupid Tactics (Score:5, Informative)
Just like gravity
False [justfuckinggoogleit.com]
Citation needed [wikipedia.org]
Parent
Science...It Works.... (Score:5, Funny)
I saw a t-shirt the other day that said:
SCIENCE
It Works, Bitches!
I thought it was funny...
Why? (Score:4, Insightful)
I don't live in the US, but have read heaps about this topic. My real question is why the subject is even being considered being added to the US school curriculum. There are lame attempts and arguments that go along the line of we want to be "balanced", but, frankly, creationism is not accepted science (it doesn't even come close to science). It's great to debate these things (it broadens our minds), but schools should teach fact; not conjecture.
Evolution is not "fact" either (although the accumulated data supports the theory). If another theory comes along that explains the data better, then Darwin's theory will be superseded. This is how science works. Teaching crackpot "theories" in schools doesn't end up making people more objective. I would suggest that it teaches them to be more stupid. Teach critical thinking. Don't teach things that are not falsifiable. It's easy.
It's not a debate it's arguing absurdity.
Epicurus said it best (Score:5, Informative)
The Riddle of Epicurus
~~~~~~~~~~~~~
If God is willing to prevent evil, but is not able to
Then He is not omnipotent.
If He is able, but not willing
Then He is malevolent.
If He is both able and willing
Then whence cometh evil?
If He is neither able nor willing
Then why call Him God?
~~~~~~~~~~~~~~
Back on topic, the Discovery institute is dedicated solely to enriching its members, any other claim is nonsense.
preaching to the choir (Score:5, Insightful)
(pun intended)
i don't think you are going to find much support for this textbook on slashdot
however, what you will find is a lot "hear, hear" and then... nothing. or worse, cynicism
there's a lot of issues in this world where all you can do is whine and bitch and moan, and are otherwise helpless to effect change. this is not one of those issues
ALL of these creationist initiatives are happening on state and local levels. you CAN do something about it if you live in one of these areas
if you do live in an area creationists are making headway, do something about it, please. if for nothing than else than simple civic pride, that the residents of your {state/ town} are not all ignorant buffoons, that some of you actually understand the value of a critical mind, and even more importantly, understand the value of an involved electorate and citizens active for causes they believe in
how is it possible that such idiots can get creationism in our schools? because THEY GET INVOLVED
there are too many voices here on slashdot that will speak loudly about right and wrong, and never actually get involved to make sure their government stands up for that
please, do not feed me the standard psychological lines of learned helplessness that convinces you you can effect no change on this issue or that issue. on creationism, on a state and local level, you CAN do something about this. you SHOULD do something about this. DO IT
if not you, who?
Hot Topic? (Score:4, Informative)
From the summary:
It's only a hot topic here in the United States. In the rest of the civilized world, ID is dismissed as the nonsense it is.
mandated (Score:4, Insightful)
Umm, the linked article says nothing about ID being mandated, it talks about legislation that would allow schools to teach it, not require them to do so. It's dumb legislation, but attacking intellectual dishonesty with more intellectual dishonesty doesn't really help your case.
Re:So let them. (Score:5, Insightful)
Parent
Re:So let them. (Score:4, Insightful)
The reason they don't teach what you say is because it is false. It simply isn't true that evolution is "a broken, flailing ship being tossed from its course every five years" or that evolution is popular because it appeals to atheists. You have to know something about evolutionary biology to understand why the former is false, but to see that the latter is false you need only realize that there are far fewer atheists than people who accept evolution and that many non-atheists, including most Jews, Catholics, and mainline Protestants, accept evolution.
Incidentally, it is quite possible to believe in god without believing in the literal truth of Genesis. Numerous people outside the Judaeo-Christian tradition do. And on the other hand, evolution is hardly necessary to discredit literal belief in Genesis. Genesis isn't even internally consistent.
Parent
I'm sorry (Score:4, Funny)
are you suggestion that there is any occasion where it is proper to diss the volcano god?
What the hell is wrong with you- do you want to be responsible for the entire town burning down?
don't you care about your neighbors or family at all?
dang- move far away from everyone before you say anything like that again please.
Parent
Re:So let them. (Score:5, Insightful)
Why are we fighting this? It's futile. Let them believe what they will believe, let them teach what they want
If that's the case, why are you posting your own opinion on slashdot? Let the slashdot readers believe what they will believe and let the submitters submit what they want.
You fail to understand that if they do WHATEVER IT TAKES to convince other people of their truth, those converted people will do WHATEVER IT TAKES to convince EVERYONE of their truth. If we don't do anything to stop them, soon it will be 1984 all over the country. And I'd say we're on the edge of seeing that happening.
Parent
Re:So let them. (Score:5, Insightful)
When I'm a decade or two older, the young people who will be affected by these decisions today will just be entering the workforce, bringing their bright new ideas into focus, and beginning to drive the next round of scientific and technological advances.
I do not want these people to believe that one of the most successful, important, and useful scientific theories in history is a lie. I do not want these people to believe that "God did it" is any kind of reasonable scientific answer. I don't want the doctors and medical researchers who determine the length and quality of my old age to be spouting off about "irreducible complexity" and other such nonsense.
You're wrong about losing the battle. Here we are conversing on a globe-spanning information network using unimaginably powerful computing machines. We've always won, and we'll keep on winning, because in the end we're right and they're wrong. But it won't be thanks to people like you.
Parent
Re:Personally (Score:4, Insightful)
Evolution is one of the cornerstones for modern biology. You don't want it taught even though it has withstood over 100 years of scrutiny and is incredibly accepted by the scientific community? Why? Because you don't understand it most likely.
Parent
Re:Personally (Score:5, Insightful)
Well step up young man and claim your Nobel prize that's waiting you.
Where did he get his (mis)information from? It's not the local drug dealers. It's not the science classes. It's not video games.
It's the churches.
There are many churches that deal in lies to peddle their agenda of pushing evolution out of the classroom. It's not a conspiracy theory it's a fact of life in this country.
If man came from monkeys why are there still monkeys? People ask that because they've been told that. They've been told that is a hole in evolutionary theory so they parrot it. They aren't told that at the drive through line at McDonalds. They are only told that type of information in religious circles.
I used to argue with Answers in Genesis for years. It was like pulling teeth trying to get them to remove content that was completely non-factual or completely taken out of context. Letter after letter would be sent with references to the correct information, but it would take months or years (or sometimes never) to get them to correct their website. Even though they updated their site regularly. There was no incentive for them to provide correct information because incorrect information is the only way they could build their case against evolution.
The fact that some Christians can't reconcile their religion with a very well grounded theory that has withstood the rigors of science for over 100 years isn't my problem.
Parent
"No one can prove Evolution"??? (Score:4, Informative)
WTF are you talking about? ... ? Random number generators? Do you have an alternate explanation for Polymerase Chain Reaction? Well then, if you agree with DNA sequencing, how do you explain that everything we sequence fits just right with evolutionary theory?
Why do you think Evolution is on less solid grounds than, say, quantum theory or heliocentrism?
For heliocentrism, we have probes and satellites taking nice pictures.
For evolution, we have fossils backed by geology, chemistry, atomic physics and so on; we also have ****DNA*** fucking SEQUENCING. Where do you think biologist get those ATTAACGGGCGTGTAAGGCGTGAAA
Evolution is much more obvious than most of quantum physics or relativity. Do you also have an opinion about frame dragging or black body radiation? What about tunnel effect?
What does your bible (or whatever source of superstition is it you use) say about the wave-particle duality? Isn't THAT weirder than natural selection? C'm'on, genes mutate and unfit individuals don't get to reproduce. That's straightforward. But Hawking's radiation? The Standard Model? Is more or less problematic to you than the evolution of species by the means of natural selection?
And we both agree that alchemy shouldn't be taught in the classroom, are you going to ask that chemistry, too, be withheld? What about astrology and astronomy?
Parent
Re:Personally (Score:4, Insightful)
No, you do not. You subscribe to an unsupported and unsupportable myth, and see nothing wrong with your personal mythology being taught to children as established fact. That makes you not only ignorant, but dangerous. Look, the human race already suffered through a long interval of ignorance and misery, with reason taking a back seat to religion. We know that time as the Dark Ages. People who clung to their beliefs in spite of all evidence to the contrary were responsible, and it could happen again.
We'll see how your faith holds up when the lights go out for good. Civilization is fragile. Believe it.
Parent
Re:No, it doesn't. (Score:4, Insightful)
In your first paragraph, you are making an a priori assumption that schools which teach ID also teach critical thought. I find that very unlikely, since acceptiong ID requires limited critical thinking abilities.
As per the bias of the reviewer, well that's pretty obvious. I think part of the reason impartial dialog is becoming increasingly scare among evolution proponents is due to the techniques ID proponents have employed. While I agree the entire debate needs to be had at a lower grade level, so that everyone can partake, I don't think the maturity should sink to the same grade level. And I'm certain this last statement appears biased to a pro ID reader.
The main thing that bothers me is the cultural framework this creates of closing science into dogma.
What was that about strawmen? /grin
Parent
Re:Yeah (Score:5, Informative)
Darwin's Black Box [wikipedia.org] was shown to be wrong in the Dover trial. Behe's central premise that things are irreducibly complex was proven wrong both with hard scientific data (about the flagella being irreduceably complex, but the bacterial Type III secretory system has a subset of the parts, though they serve a different function) and logically (Behe says a mousetrap is irreducibly complex, but it is useful as a tie clip if you remove two key parts).
The judge in the Dover trial summed it up by saying [wikipedia.org]:
Parent
Re:Yeah (Score:5, Insightful)
Regardless of those two examples, the entire concept of irreducible complexity is complete bullshit.
Evolution does not simply add parts. It also removes them. And indeed there is a great incentive for this to happen, as every unnecessary part is an added metabolic cost to the organism which contains it.
So let's say for a moment that some structure was discovered that were irreducibly complex. Does that disprove evolution? Absolutely not! It just means that the structure evolved from something more complex, not less.
Parent
Re:Yeah (Score:5, Informative)
I'm not sure how best to explain it so I'll try with a simple example.
Let's say the structure you're trying to evolve can be represented as ABC. The letters are different parts. Together, ABC performs some useful function. Maybe it senses light, or moves the organism, or converts energy. Doesn't matter.
Now imagine that AB and BC are both useless constructs. The stance of the IDers is that ABC would have to evolve from constituent parts, by starting with one letter and adding more until ABC is achieved. But, they claim, since both AB and BC are useless, they would never evolve, and so ABC could never come to be. Therefore, the existence of ABC in an organism is, essentially, proof that God Did It.
However, imagine if C is some sort of useful construct all by itself. The actual function of C could be completely different from the function of ABC, it just has to be useful in some fashion. Then we add D, another part which is not part of ABC, to form CD. Imagine that CD is also useful in some manner, potentially related to C, potentially not. Then B is added which gives it more of a useful function, so organisms have the useful construct BCD. Then A is added to give the final functionality in the more complex form of ABCD. Then D, being redundant, is eventually dropped from the organism. Therefore you have evolved the useful and "irreducibly complex" construct ABC from parts.
Parent
Re:Yeah (Score:5, Insightful)
So: consider the arch bridge.
An arch bridge is held up by internal pressure. Remove any part of the arch bridge and the whole thing falls into the river. An arch bridge is irreducibly complex, by the creationists' definition. It works as a whole, or not at all; take any part away and it collapses.
Does that mean, then, that all the arch bridges in the world were assembled all at once? Shipped pre-fab to the site and installed as a whole?
Not at all! When we build such things, we use scaffolding. We first build a huge, clumsy, inefficient structure, a grid of poles and joints. This structure is flimsy, it cannot bear very great weight, nor carry much traffic - but it does span the river, it is indeed a bridge. And it can be built up piece by piece - it will stand up even if the span is not complete. Then we work on the arch bridge itself. We build up stone alongside our scaffolding. The scaffolding holds up the stone and the stone braces the scaffolding. Each new stone added strengthens the whole structure.
And there comes a day when the arch bridge is completed. Now we find that the whole scaffolding structure is redundant - it can be done away with. That leaves only the arch. The irreducibly complex arch.
The same could easily go for living things. Evolution can take away as well as add, and if some older structure has been made redundant by a newer development that grew from it, then that structure can surely be done away with. Behe's notion of irreducible complexity would only be a problem if evolutionary theory only allowed for organisms to become more complex over time - but if an organism is already complex, and it happens to benefit that species to become simpler, then it will do so. And it might well arrive at an 'irreducibly complex' structure from above.
It's all a hangover of the old idea of a 'great chain of being'. It's a common misconception: men are more advanced than apes, which are more advanced than dogs, which are more advanced than... you get the picture. This is the kind of thinking where the X-Men are the 'next stage' of evolution. Evolution doesn't work that way. There's no great plan, no distant goal, no inevitable increase of sophistication. Evolution does whatever works, and if that means eliminating redundancies, refactoring, and going ahead with a simpler design, then so be it.
Parent
Re:Yeah (Score:4, Insightful)
In fact, of course, the bridge is the remainder of a larger, still more complex system of bridge plus scaffolding, most of which has been removed as being redundant.
The same goes for the supposed 'irreducibly complex' structures put about by creationists. They argue that the removal of any part of such structures would cause the whole to fail completely. Perhaps they're even right. But the discussion of the arch bridge shows that it's possible to arrive at such a structure by subtraction, rather than by addition: the 'irreducible' structure exists as a relic of a more complex, less efficient system, hacked together ad hoc, which did the job poorly but nonetheless did it - and which was then gradually optimised until it achieves the engineer's perfection, when there is nothing left to take away.
Parent
Re:Yeah (Score:5, Insightful)
You can imply that there is bias all you want, but there is one very big difference between the two. The biologist has studied biology, the scientific process involved in researching the subject and is able to make an evidenced based critique of an ID argument.
Rebuttals from the ID camp contain no such expertise or references, and are usually based on long refuted arguments against evolution, but little or nothing that truly supports ID.
This isn't a case where he-said she-said attempts to discredit both sides will work. One side clearly has evidence on their side, and the other does not.
Parent
Re:Evolution textbook!? (Score:5, Insightful)
And while we're at it, can we stop giving:
^ These idiots a veneer of respect by treating them as if they're rational? They AREN'T. They are functional (but nevertheless, crazy as a shithouse rat) religious zealots who do not respect science unless it serves their beliefs (see also: nuclear power, IC engine, medicine, etc.).
Parent
Re:Evolution textbook!? (Score:5, Insightful)
They are functional (but nevertheless, crazy as a shithouse rat) religious zealots
I think it's worth pointing out - particularly to people in the US - that the Muslim countries of the Middle East led the world in science and technology, once. Why do you think so many stars have Arabic names? Why do so many words in science have Arabic roots? Think carefully...
Now think about what happened when they let the conservative religious crazies take control.
Just sayin'
Parent
Re:Evolution textbook!? (Score:4, Informative)
> Now think about what happened when they let the conservative religious crazies take control.
Methinks history betrays you.
The Wahabbi extremists (Islamic versions of the US fundamentalist extremists) came to power with ibn Saud, in the 18th century.
Economic power (and scientific luminance) seeped away from the Caliphates and kingdoms of the Levant when the sea routes were broken open, most notably and astoundingly at Lepanto.
Parent
Re:Evolution textbook!? (Score:5, Interesting)
There followed a long decline. Wars, on and off, with the crusaders of Europe raiding into the Middle East. Various rulers of Arabic and Persian and Turkish dynasties competing for domination of the Islamic world. A gradual eclipse as the nations of Europe set about building their empires. And finally irrelevance, a culture respected only insofar as it provides crude oil to its betters. Small wonder that a civilisation brought so low from such a glorious past turns to its god for answers, and finds dark counsels.
Parent
Re:Evolution textbook!? (Score:5, Interesting)
"Therefore, the seeker after the truth is not one who studies the writings of the ancients and, following his natural disposition, puts his trust in them, but rather the one who suspects his faith in them and questions what he gathers from them, the one who submits to argument and demonstration, and not to the sayings of a human being whose nature is fraught with all kinds of imperfection and deficiency. Thus the duty of the man who investigates the writings of scientists, if learning the truth is his goal, is to make himself an enemy of all that he reads, and, applying his mind to the core and margins of its content, attack it from every side. He should also suspect himself as he performs his critical examination of it, so that he may avoid falling into either prejudice or leniency."--Ibn al-Haytham
http://en.wikipedia.org/wiki/Ibn_al-haytham [wikipedia.org]
This is what too few human beings do, they always trust in what they have been taught... when much of what they know is fraught with error. I am weary of anything I say as well as anything any other man says, that cannot be demonstrated. Therefore, I only defend what can be demonstrated.
The majority of people do not take the above view, they are overconfident in what they think they know when they hardly know anything at all.
Parent
Re:Bad Science all around. (Score:4, Insightful)
No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.
If something cannot be questioned, then it does not belong in a science laboratory, it belongs in pulpit in a church. The concept of QUESTIONING is what gives science its bad ass record.
The luminiferous ether was widely regarded as the only way for light to behave the way it did. Light was a wave, and that explained the double slit experiment.
Then a few jerks were just messing around and bang, the ether is GONE. The discovery was so important, it got one of those jerks a Nobel Prize. When somebody says they have an idea that's totally irrefutable, their idea isn't science. Even various aspects of evolution are able to be falsified, for example, if a fossilized cat were found in the Jurassic period, then that would throw common decent right out the window. It's doubtful for that to happen, considering the mountains of evidence that support common decent, but it's never going to be an unquestioned fact. An absolute fact would require absolute proof, and the only tool that provides absolute proof is mathematics.
Parent